Home > Products > RNA-Related > IAM19 RNA-Related

PrimeIAmp™ COVID-19 Lyophilized Fluorescence Nucleic Acid Detection Kit


Cat. No.

Size

Price (US$)

IAM19-48

48T

432.00

IAM19-2400

2,400T

10800.00


Description

PrimeIAmp™ COVID-19 Lyophilized Fluorescence Nucleic Acid Detection Kit is especially suitable for the detection of food packaging and utensils swab, nasal swab, oral swab and anal swab. These samples can be directly used for the detection without nucleic acid purification. PrimeIAmp™ COVID-19 Lyophilized Fluorescence Nucleic Acid Detection Kit is in lyophilized form. The primers are lyophilized at the bottom of the tube, and the reagent is lyophilized as microspheres.

Features

  • lHigh Sensitivity: When using swab solution directly (without nucleic acid purification), the sensitivity is 300 viruses / swab. In the COVID-19 plasmid standard test, the sensitivity is 5 copies / test.

  • lEasy Operation: Nucleic acid purification is not needed, and swab solution can be used directly. In 25 μl reaction system, 22 μl swab solution can be used.

  • lFast Speed: The detection can be completed within 15 minutes at 65°C.

  • lConvenient Transportation: The kit can be transported at room temperature.

Target Region

AACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTCTACTTG

Storage

Minimum shelf life is 1 year at 2-8°C. At the bottom of the tube, the primers are lyophilized. The lyophilized beads contain reaction buffer, Mg2+, dNTP, Bst DNA/RNA polymerase, etc. The kit can be transported at room temperature.

Instruction: Protocol

Only for research and not intended for treatment of humans or animals


HOME    |    About US    |    NEWS    |    Products    |    Support    |    Promotion    |    Distributor    |    Order